The detailed information of tRNA gene sequence


Sequence ID>W1610575824
Genome IDLAGS01000032
Search identical group
Phylum/Classunclassified bacteria
Speciesbacteria symbiont BFo2 of Frankliniella occidentalis (LAGS)
Start position on genome 517
End posion on genome 591
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tacgtgcaag
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tctactcctc
Secondary structure (Cloverleaf model)
>W1610575824	Arg	CCT
                   g      ACCA tctactcctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK