The detailed information of tRNA gene sequence


Sequence ID>W1610613586
Genome IDLGGA01000005
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesAtribacteria bacterium 34_128 (LGGA)
Start position on genome 10132
End posion on genome 10208
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
gtaatatctc
tRNA gene sequence
GCGCCTGTGGCTCAATAGGATAGAGCAACGGACTTCTAATCCGTAGGTTGGGGGTTCGAT
TCCCTCCAGGCGCGCCA
Downstream region at tRNA end position
ttttaaaata
Secondary structure (Cloverleaf model)
>W1610613586	Arg	TCT
                   c      GCCA ttttaaaata
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     T - A
                     G - C          T T
                    T     C T C C C     A
      T A A        G      | + | | |     G
    A       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        A     AGGTT
                    A - T
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK