The detailed information of tRNA gene sequence


Sequence ID>W1610613590
Genome IDLGGA01000005
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesAtribacteria bacterium 34_128 (LGGA)
Start position on genome 10609
End posion on genome 10693
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
aaataaaaat
tRNA gene sequence
GCGAGGGTGGTGGAATTGGTAGACACGCTGGATTTAGGATCCAGTGGGTAACTCCATGCG
GGTTCGAGTCCCGCCCTTCGCACCA
Downstream region at tRNA end position
aaaaatacga
Secondary structure (Cloverleaf model)
>W1610613590	Leu	TAG
                   t      ACCA aaaaatacga
                     G - C
                     C - G
                     G - C
                     A - T
                     G + T
                     G - C
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    T       G G T G       G C G G G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGGTAACTCCAT
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  T       A
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK