The detailed information of tRNA gene sequence


Sequence ID>W1610613591
Genome IDLGGA01000015
Search identical group
Phylum/ClassCandidatusAtribacteria
SpeciesAtribacteria bacterium 34_128 (LGGA)
Start position on genome 13842
End posion on genome 13918
Amino Acid Pro
Anticodon GGG
Upstream region at tRNA start position
atgtaaaagt
tRNA gene sequence
CGGGGCGTAGCGCAGTTTGGAAGCGCACCTGAATGGGGTTCAGGGGGTCGGAGGTTCAAG
TCCTCTCGCCCCGACCA
Downstream region at tRNA end position
gaatattttt
Secondary structure (Cloverleaf model)
>W1610613591	Pro	GGG
                   t      ACCA gaatattttt
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     T C T C C     A
      T G A        A      + | | | |     A
    T       C G C G       G G A G G     C
    T       | | | |                 T T
    G       G C G C
      G A A        A     GGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  A       T
                  T       G
                    G G G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK