The detailed information of tRNA gene sequence


Sequence ID>W1610614353
Genome IDLGHB01000001
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanosaeta harundinacea [LGHB]
Start position on genome 5633
End posion on genome 5561
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tttgctctga
tRNA gene sequence
GTCCGGATAGTGTAGAGGCCTATCATGAAGCCCTGTCGAGGCTTCGACCCGGGTTCGACT
CCCGGTCCGGGCGtta
Downstream region at tRNA end position
aaggggcgca
Secondary structure (Cloverleaf model)
>W1610614353	Asp	GTC
                   a      Gtta aaggggcgca
                     G - C
                     T + G
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T          T C
                    T     G G C C C     A
      A G A        A      | | | | |     G
    G       T G T G       C C G G G     C
    G         | | +                 T T
    C       T C A T
      C T A        G     CGAC
                    A - T
                    A - T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       G
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK