The detailed information of tRNA gene sequence


Sequence ID>W1610625688
Genome IDLIAY01000139
Search identical group
Phylum/ClassActinobacteria
SpeciesMicrobacteriaceae bacterium BACL25 MAG-120322-bin65 (LIAY)
Start position on genome 2385
End posion on genome 2301
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
gggagcgcat
tRNA gene sequence
GGCGAGTTACCCAAGCGGCCAAAGGGATCTGACTGTAACTCAGCTGGCTTAGCCTTCGGG
GGTTCGAATCCCTCACTCGCCACAA
Downstream region at tRNA end position
aatgtcgcaa
Secondary structure (Cloverleaf model)
>W1610625688	Tyr	GTA
                   t      ACAA aatgtcgcaa
                     G - C
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     T - A          T A
                    T     C T C C C     A
      C G A        A      | + | | |     G
    G       A C C C       G G G G G     C
    G         | | |                 T T
    C       A G G G
      C A A        A     TGGCTTAGCCTTC
                    T   C
                    C - G
                    T - A
                    G - C
                    A - T
                  C       C
                  T       A
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK