The detailed information of tRNA gene sequence


Sequence ID>W1610625714
Genome IDLIBA01000004
Search identical group
Phylum/ClassActinobacteria
SpeciesMicrobacteriaceae bacterium BACL28 MAG-120531-bin53 (LIBA)
Start position on genome 5216
End posion on genome 5132
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
tgttgttgtc
tRNA gene sequence
GCGGGTGTGGCGAAATTGGCAGACGCACCAGATTTAGGATCTGGCGCCGCGAGGCGTGGG
GGTTCAAGTCCCTTCACCCGCACAA
Downstream region at tRNA end position
ataaaaaggg
Secondary structure (Cloverleaf model)
>W1610625714	Leu	TAG
                   c      ACAA ataaaaaggg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T G
                    T     T T C C C     A
      T A A        G      + + | | |     A
    T       A G C G       G G G G G     C
    G         | | |                 T T
    G       A C G C
      C A G        A     CGCCGCGAGGCGT
                    C - G
                    C - G
                    A - T
                    G - C
                    A - T
                  T       A
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK