| Sequence ID | >W1610638220 |
| Genome ID | LIXN01000003 |
| Phylum/Class | Euryarchaeota |
| Species | Thermococcus thioreducens DSM 14981 [LIXN] |
| Start position on genome | 182213 |
| End posion on genome | 182289 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
tatttcgggc |
| tRNA gene sequence |
GGGCCCGTGGTCTAGATGGTTATGACGCCACCCTTACAAGGTGGAGGTCCGGGGTTCGAA |
| Downstream region at tRNA end position |
gttctcgatt |
| Secondary structure (Cloverleaf model) | >W1610638220 Val TAC
c ACCA gttctcgatt
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T G C C C C A
A G A G | | | | | G
T T C T G C G G G G C
G | | | T T
G T G A C
T T A G AGGTC
C - G
C - G
A - T
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |