The detailed information of tRNA gene sequence


Sequence ID>W1610662541
Genome IDLJTR01000233
Search identical group
Phylum/ClassPlanctomycetes
SpeciesPhycisphaerae bacterium SG8_4 (LJTR)
Start position on genome 3471
End posion on genome 3396
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
gcggattgtC
tRNA gene sequence
GCGCCCGTAGCTCAATTGGATAGAGTCGCGGACTTCGAATCCGAAGGTTGCAGGTTCGAG
TCCTGCCGGGCGCGTtg
Downstream region at tRNA end position
atatgaaagg
Secondary structure (Cloverleaf model)
>W1610662541	Arg	TCG
                   C      GTtg atatgaaagg
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     C G T C C     A
      T A A        A      | | | | |     G
    T       C T C G       G C A G G     C
    G       | | | +                 T T
    G       G A G T
      A T A        C     AGGTT
                    G   A
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK