| Sequence ID | >WENV074343 |
| Genome ID | AACY023970415 |
| Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
| Species | |
| Start position on genome | 283 |
| End posion on genome | 369 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
gtgaaatttT |
| tRNA gene sequence |
GGGGAGATACTCAAGCGGCCAACGAGGACGGACTGTAACTCCGTTGACTACGTCTTCGCA |
| Downstream region at tRNA end position |
Tattcattta |
| Secondary structure (Cloverleaf model) | >WENV074343 Tyr GTA
T ACAA Tattcattta
G - C
G - C
G - C
G - C
A - T
G - C
A - T T A
T C G T C C A
C G A A | | | | | G
G A C T C G C A G G C
G | | | T T
C C G A G
C A A G TGACTACGTCTTC
A - T
C - G
G - C
G - C
A - T
C C
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |