The detailed information of tRNA gene sequence


Sequence ID>W1610685897
Genome IDLKUC01000078
Search identical group
Phylum/ClassBetaproteobacteria
SpeciesSmithella sp. SDB (LKUC)
Start position on genome 2253
End posion on genome 2328
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
aataaatttt
tRNA gene sequence
GCCCACGTAGCTCAGTCGGTAGAGCACATCCTTGGTAAGGATGAGGTCACCAGTTCAATC
CTGGTCGTGGGCTCCA
Downstream region at tRNA end position
gctaaggagt
Secondary structure (Cloverleaf model)
>W1610685897	Thr	GGT
                   t      TCCA gctaaggagt
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     C - G
                     G - C          C T
                    T     T G G T C     A
      T G A        A      | | | | |     A
    C       C T C G       A C C A G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK