The detailed information of tRNA gene sequence


Sequence ID>W1610716523
Genome IDLLWQ01000093
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. MKU1 (LLWQ)
Start position on genome 3007
End posion on genome 2912
Amino Acid SeC(p)
Anticodon TCA
Upstream region at tRNA start position
gcgggactag
tRNA gene sequence
GGAAGAGAAGCGTCCCCGGTGGGGCGGCCGGACTTCAAATCCGGTTGGGGCAGTGAGCCT
GTCCCGGGTGGGTTCGACTCCCACTCTCTTCCGCCA
Downstream region at tRNA end position
gatgcgatga
Secondary structure (Cloverleaf model)
>W1610716523	SeC(p)	TCA
                   g      GCCA gatgcgatga
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T C
                    A     C A C C C     A
      C C C        G      | | | | |     G
    G       C T G C       G T G G G     C
    G       | + | |                 T T
    T       G G C G
      G G          G     TTGGGGCAGTGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK