The detailed information of tRNA gene sequence


Sequence ID>W1610716552
Genome IDLLWQ01000219
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. MKU1 (LLWQ)
Start position on genome 32621
End posion on genome 32694
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gccgggcctc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
gcctttcctg
Secondary structure (Cloverleaf model)
>W1610716552	Gly	CCC
                   c      TCCA gcctttcctg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK