The detailed information of tRNA gene sequence


Sequence ID>W1610724967
Genome IDLMEN01000005
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesEnsifer sp. Root1298 (LMEN)
Start position on genome 19655
End posion on genome 19751
Amino Acid SeC(p)
Anticodon TCA
Upstream region at tRNA start position
tgcgcgctgA
tRNA gene sequence
GGAAGGGAATCGTCTCCGGTGGGACGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT
GTCCCGGGTGGGTTCGACCCCCACTCCCCTCCGCC
Downstream region at tRNA end position
Agcgctcacg
Secondary structure (Cloverleaf model)
>W1610724967	SeC(p)	TCA
                   A      CGCC Agcgctcacg
                     G - C
                     G + T
                     A   C
                     A   C
                     G - C
                     G - C
                     G + T          C C
                    A     C A C C C     A
      C T C        A      | | | | |     G
    C       T G C T       G T G G G     C
    G       +     +                 T T
    G       G A C G
      T G G        G     TTGGGGCAGCGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK