The detailed information of tRNA gene sequence


Sequence ID>W1610732358
Genome IDLMKE01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf10 (LMKE)
Start position on genome 365055
End posion on genome 364979
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgcgtcgat
tRNA gene sequence
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG
TCCCTCCGAGGCCACCA
Downstream region at tRNA end position
tcgcccctga
Secondary structure (Cloverleaf model)
>W1610732358	Arg	CCT
                   t      ACCA tcgcccctga
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK