The detailed information of tRNA gene sequence


Sequence ID>W1610732726
Genome IDLMKL01000007
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf17 (LMKL)
Start position on genome 51912
End posion on genome 51988
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ggtgcgcatt
tRNA gene sequence
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA
TCTCGCCGGGGGCACCA
Downstream region at tRNA end position
gttttacggc
Secondary structure (Cloverleaf model)
>W1610732726	Arg	CCT
                   t      ACCA gttttacggc
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C T C     A
      C G A        A      | | |   |     A
    C       C T C G       G C G T G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGCC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK