The detailed information of tRNA gene sequence


Sequence ID>W1610732996
Genome IDLMKR01000003
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf23 (LMKR)
Start position on genome 804952
End posion on genome 804876
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgtgcgcgt
tRNA gene sequence
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG
TCCCTCCGAGGCCACCA
Downstream region at tRNA end position
gtttcgcgaa
Secondary structure (Cloverleaf model)
>W1610732996	Arg	CCT
                   t      ACCA gtttcgcgaa
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK