The detailed information of tRNA gene sequence


Sequence ID>W1610733063
Genome IDLMKT01000001
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf226 (LMKT)
Start position on genome 344568
End posion on genome 344644
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tcgcgtgcgt
tRNA gene sequence
GGCCCCGTAGCTCAGCCGGATAGAGCACCAGATTCCTAATCTGGGGGCCAGTGGTTCAAA
TCCACTCGGGGTCACCA
Downstream region at tRNA end position
ccaccgacat
Secondary structure (Cloverleaf model)
>W1610733063	Arg	CCT
                   t      ACCA ccaccgacat
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T C A C C     A
      C G A        A      | | | | |     A
    C       C T C G       A G T G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        A     GGGCC
                    C - G
                    C - G
                    A - T
                    G - C
                    A - T
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK