The detailed information of tRNA gene sequence


Sequence ID>W1610738823
Genome IDLMPG01000012
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas sp. Leaf343 (LMPG)
Start position on genome 291222
End posion on genome 291146
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcgccgacgt
tRNA gene sequence
GGTTCCGTAGCTCAGCTGGACAGAGCGCCACTTTCCTAAAGTGGGCGTCGGGGGTTCGAG
TCCCTCCGGGACCACCA
Downstream region at tRNA end position
ttttccttaa
Secondary structure (Cloverleaf model)
>W1610738823	Arg	CCT
                   t      ACCA ttttccttaa
                     G - C
                     G - C
                     T - A
                     T + G
                     C - G
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    A - T
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK