The detailed information of tRNA gene sequence


Sequence ID>W1610754405
Genome IDLNFL01000078
Search identical group
Phylum/ClassActinobacteria
SpeciesActinobacteria bacterium Ga0077560 (LNFL)
Start position on genome 7186
End posion on genome 7112
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
tcacgagcgt
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACtc
Downstream region at tRNA end position
agaaaggccc
Secondary structure (Cloverleaf model)
>W1610754405	Met	CAT
                   t      ACtc agaaaggccc
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK