| Sequence ID | >W1610840620 |
| Genome ID | LPRZ01000002 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus acidocaldarius NG05B_C06_03 [LPRZ] |
| Start position on genome | 155437 |
| End posion on genome | 155351 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tcttattaaT |
| tRNA gene sequence |
GCCGGGGTGCCCGAGTGGACTAAGGGGCTGGCCTGGAGAGCCAGTGTGGATCTTCCACGC |
| Downstream region at tRNA end position |
tgggggattc |
| Secondary structure (Cloverleaf model) | >W1610840620 Ser GGA
T GTag tgggggattc
G - C
C - G
C - G
G - C
G - C
G - C
G - C T A
T C G C C C A
T G A G | | | | | A
G G C C C G C G G G C
G | | | T T
A A G G G
C T A G TGTGGATCTTCCACGC
C - G
T - A
G - C
G - C
C - G
C A
T G
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |