The detailed information of tRNA gene sequence


Sequence ID>W1610918393
Genome IDLSOC01000004
Search identical group
Phylum/ClassFirmicutes
SpeciesHalobacillus sp. KGW1 (LSOC)
Start position on genome 45898
End posion on genome 45825
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
ttcaaaatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACtt
Downstream region at tRNA end position
cgatataaaa
Secondary structure (Cloverleaf model)
>W1610918393	Ala	GGC
                   c      ACtt cgatataaaa
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK