The detailed information of tRNA gene sequence


Sequence ID>W1610935602
Genome IDLUKI01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesGammaproteobacteria bacterium F7 (LUKI)
Start position on genome 21567
End posion on genome 21492
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
cctcttctgg
tRNA gene sequence
GGGCCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGCTGGTTCGAAT
CCAGCACGGCCCACCA
Downstream region at tRNA end position
ccagaagtcc
Secondary structure (Cloverleaf model)
>W1610935602	Lys	TTT
                   g      ACCA ccagaagtcc
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     C G A C C     A
      T G A        A      | | | | |     G
    T       C T C G       G C T G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TGGTC
                    G + T
                    T - A
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK