The detailed information of tRNA gene sequence


Sequence ID>W1610954513
Genome IDLVHK01000030
Search identical group
Phylum/ClassCyanobacteria
SpeciesProchlorococcus sp. MIT 1303 (LVHK)
Start position on genome 21049
End posion on genome 21130
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
agtcggccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttc
Downstream region at tRNA end position
tttccttaca
Secondary structure (Cloverleaf model)
>W1610954513	Leu	GAG
                   c      Attc tttccttaca
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK