The detailed information of tRNA gene sequence


Sequence ID>W1610954906
Genome IDLVHT01000005
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. MIT S9504 (LVHT)
Start position on genome 44183
End posion on genome 44093
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tcgtgccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTat
Downstream region at tRNA end position
cagaccatat
Secondary structure (Cloverleaf model)
>W1610954906	Ser	GCT
                   T      GTat cagaccatat
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK