The detailed information of tRNA gene sequence


Sequence ID>W1610954953
Genome IDLVHU01000006
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. MIT S9508 (LVHU)
Start position on genome 43319
End posion on genome 43229
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gcgggccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtg
Downstream region at tRNA end position
aattgaacag
Secondary structure (Cloverleaf model)
>W1610954953	Ser	GCT
                   T      GTtg aattgaacag
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK