The detailed information of tRNA gene sequence


Sequence ID>W1610955002
Genome IDLVHV01000015
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. MIT S9509 (LVHV)
Start position on genome 48665
End posion on genome 48584
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
aatcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
tttcccaaat
Secondary structure (Cloverleaf model)
>W1610955002	Leu	GAG
                   c      Attt tttcccaaat
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK