The detailed information of tRNA gene sequence


Sequence ID>W1610977668
Genome IDLVWG01000036
Search identical group
Phylum/ClassChlorobi
SpeciesPelodictyon luteolum (LVWG)
Start position on genome 120132
End posion on genome 120055
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
actctttcac
tRNA gene sequence
GGAGCTGTAGCTCAGTCTGGTTAGAGCGCCTGCCTGTCACGCAGGAGGTCGCGGGTTCGA
GCCCCGTCAGCTCCGCAA
Downstream region at tRNA end position
ggaaacaagg
Secondary structure (Cloverleaf model)
>W1610977668	Asp	GTC
                   c      GCAA ggaaacaagg
                     G - C
                     G - C
                     A - T
                     G - C
                     C - G
                     T - A
                     G - C          C G
                    T     T G C C C     A
    C T G A        A      + | | | |     G
  T         C T C G       G C G G G     C
  G         | | | |                 T T
  G         G A G C
    T T A          G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK