The detailed information of tRNA gene sequence


Sequence ID>W1610996311
Genome IDLXGJ01000272
Search identical group
Phylum/ClassFirmicutes
SpeciesBrevibacillus sp. WF146 (LXGJ)
Start position on genome 2498
End posion on genome 2573
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
aacgagatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAAC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
acatattaaa
Secondary structure (Cloverleaf model)
>W1610996311	Ala	GGC
                   c      ACCA acatattaaa
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C A
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK