The detailed information of tRNA gene sequence


Sequence ID>W1611052311
Genome IDMAEO01000109
Search identical group
Phylum/ClassBetaproteobacteria
SpeciesSmithella sp. M82 (MAEO)
Start position on genome 42043
End posion on genome 41968
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
attgaataag
tRNA gene sequence
GCGGGAGTAGCTCAGTGGCTAGAGCGTCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAAT
CCCGTTTCCCGCTCCA
Downstream region at tRNA end position
gaaaaaaagg
Secondary structure (Cloverleaf model)
>W1611052311	Gly	TCC
                   g      TCCA gaaaaaaagg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     G + T          T A
                    T     T G C C C     A
      T G A        A      + | | | |     G
    G       C T C G       G C G G G     C
    G       | | | |                 T T
    C       G A G C
      T A          G     GGGTC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK