The detailed information of tRNA gene sequence


Sequence ID>W1611052312
Genome IDMAEO01000109
Search identical group
Phylum/ClassBetaproteobacteria
SpeciesSmithella sp. M82 (MAEO)
Start position on genome 41936
End posion on genome 41861
Amino Acid Thr
Anticodon GGT
Upstream region at tRNA start position
agtaaatttt
tRNA gene sequence
GCCCACGTAGCTCAGTCGGTAGAGCACATCCTTGGTAAGGATGAGGTCACCAGTTCAATC
CTGGTCGTGGGCTCCA
Downstream region at tRNA end position
gttaaggagt
Secondary structure (Cloverleaf model)
>W1611052312	Thr	GGT
                   t      TCCA gttaaggagt
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T
                     C - G
                     G - C          C T
                    T     T G G T C     A
      T G A        A      | | | | |     A
    C       C T C G       A C C A G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     AGGTC
                    C - G
                    A - T
                    T - A
                    C - G
                    C - G
                  T       A
                  T       A
                    G G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK