| Sequence ID | >WENV079759 |
| Genome ID | AATN01000298 |
| Phylum/Class | Wastewater EBPR microbial communities from Bioreactor (Australian sludge) |
| Species | |
| Start position on genome | 2164 |
| End posion on genome | 2241 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
tctctgctgC |
| tRNA gene sequence |
AGGGGCATAGCTCAACTGGCAGAGCGTCGGTCTCCAAAACCGAAGGTTGGGGGTTCGATT |
| Downstream region at tRNA end position |
Tcatcaatca |
| Secondary structure (Cloverleaf model) | >WENV079759 Trp CCA
C GCCA Tcatcaatca
A - T
G - C
G - C
G - C
G - C
C - G
A - T T T
T C T C C C A
C A A A | + | | | G
T C T C G G G G G G C
G | | | | T T
G G A G C
C A G AGGTT
T - A
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |