| Sequence ID | >WENV079856 |
| Genome ID | AATN01003659 |
| Phylum/Class | Wastewater EBPR microbial communities from Bioreactor (Australian sludge) |
| Species | |
| Start position on genome | 514 |
| End posion on genome | 439 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
aaatggttct |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAAGTCGCGGGTTCGAGT |
| Downstream region at tRNA end position |
acgaaaaatc |
| Secondary structure (Cloverleaf model) | >WENV079856 Gly GCC
t TCAA acgaaaaatc
G - C
C - G
G - C
G - C
G - C
A - T
A - T T G
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G AAGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |