| Sequence ID | >WENV079905 |
| Genome ID | AATN01007539 |
| Phylum/Class | Wastewater EBPR microbial communities from Bioreactor (Australian sludge) |
| Species | |
| Start position on genome | 287 |
| End posion on genome | 365 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tgaaataatT |
| tRNA gene sequence |
GGTCCCGTAGCTCAGCTGGATAGAGCAACAGATTTCTAATCTGTGGGTCTCAGGTTCGAA |
| Downstream region at tRNA end position |
Ttctctttta |
| Secondary structure (Cloverleaf model) | >WENV079905 Arg TCT
T ACTT Ttctctttta
G - C
G + T
T - A
C - G
C - G
C - G
G - C T A
T A G T C C A
C G A A | | | | | G
T C T C G T C A G G C
G | | | | T T
G G A G C
A T A A GGGTC
A - T
C - G
A - T
G - C
A - T
T A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |