| Sequence ID | >WENV083083 |
| Genome ID | BAAX01001810 |
| Phylum/Class | Gut microbiome of Human (healthy human sample F2-V, Adult, Male) |
| Species | |
|
Start position on genome
|
146
|
|
End posion on genome
|
70
|
|
Amino Acid
|
Ile
|
|
Anticodon
|
GAT
|
|
Upstream region at tRNA start position
|
aaatctctgc
|
|
tRNA gene sequence
|
AGGCTTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCAAG TCCACTCAGGCCTACCA
|
|
Downstream region at tRNA end position
|
aatttttgct
|
| Secondary structure (Cloverleaf model) | >WENV083083 Ile GAT
c ACCA aatttttgct
A - T
G - C
G - C
C - G
T + G
T - A
G - C T G
T T C A C C A
G G A A + | | | | A
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |