| Sequence ID | >WENV083133 |
| Genome ID | BAAX01003305 |
| Phylum/Class | Gut microbiome of Human (healthy human sample F2-V, Adult, Male) |
| Species | |
|
Start position on genome
|
659
|
|
End posion on genome
|
581
|
|
Amino Acid
|
Asp
|
|
Anticodon
|
GTC
|
|
Upstream region at tRNA start position
|
gagcgatcaT
|
|
tRNA gene sequence
|
GGCCCGGTAGCTCAGTTGGTTAGAGCACCAGCCTGTCACGCTGGGGGTCGTCGGTTCGAG CCCGATCCGGGTCGCCA
|
|
Downstream region at tRNA end position
|
Tttgctgcta
|
| Secondary structure (Cloverleaf model) | >WENV083133 Asp GTC
T GCCA Tttgctgcta
G - C
G + T
C - G
C - G
C - G
G - C
G - C C G
T T A G C C A
T G A A + | | | | G
T C T C G G T C G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
C - G
A - T
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |