| Sequence ID | >WENV083383 |
| Genome ID | BAAX01017316 |
| Phylum/Class | Gut microbiome of Human (healthy human sample F2-V, Adult, Male) |
| Species | |
|
Start position on genome
|
1198
|
|
End posion on genome
|
1106
|
|
Amino Acid
|
Ser
|
|
Anticodon
|
GCT
|
|
Upstream region at tRNA start position
|
nnnnnnnnnT
|
|
tRNA gene sequence
|
GGAGAAGTACTCAAGTGGCTGAAGAGGCGCCCCTGCTAAGGGTGTAGGTCGTTCGCGCGG CGCGAGGGTTCAAATCCCTCCTTCTCCGTTC
|
|
Downstream region at tRNA end position
|
Agacaatcct
|
| Secondary structure (Cloverleaf model) | >WENV083383 Ser GCT
T GTTC Agacaatcct
G - C
G - C
A - T
G - C
A - T
A - T
G - C T A
T C T C C C A
T G A A | | | | | A
G A C T C G A G G G C
G | | | T T
C A G A G
T G A G TAGGTCGTTCGCGCGGCGC
C - G
G + T
C - G
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |