The detailed information of tRNA gene sequence


Sequence ID>WENV084087
Genome IDBAAZ01000162
Search identical group
Phylum/ClassGut microbiome of Human (healthy human sample F2-X, Child, Male)
Species
Start position on genome 9269
End posion on genome 9193
Amino Acid Val
Anticodon GAC
Upstream region at tRNA start position
ccttgctgac
tRNA gene sequence
GGACGATTAGCTCAGCTGGCTAGAGCATCCGCTTGACGTGCGGAAGGTCATAGGTTCGAG
TCCTATATCGTCCACCA
Downstream region at tRNA end position
tataaatccc
Secondary structure (Cloverleaf model)
>WENV084087	Val	GAC
                   c      ACCA tataaatccc
                     G - C
                     G - C
                     A - T
                     C - G
                     G - C
                     A - T
                     T - A          T G
                    T     T A T C C     A
      C G A        A      | | | | |     G
    T       C T C G       A T A G G     C
    G       | | | |                 T T
    G       G A G C
      C T A        A     AGGTC
                    T - A
                    C - G
                    C - G
                    G - C
                    C - G
                  T       T
                  T       G
                    G A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK