| Sequence ID | >WENV085278 |
| Genome ID | BABC01000116 |
| Phylum/Class | Gut microbiome of Human (healthy human sample In-B, Infant, Male) |
| Species | |
|
Start position on genome
|
4033
|
|
End posion on genome
|
3959
|
|
Amino Acid
|
Glu
|
|
Anticodon
|
TTC
|
|
Upstream region at tRNA start position
|
caagttgttc
|
|
tRNA gene sequence
|
GCCCCCATCGTCTAACGGTTAGGACACCAGACTTTCAATCTGACAACGAGAGTTCGACTC TCTCTGGGGGTACGC
|
|
Downstream region at tRNA end position
|
ttccgctcct
|
| Secondary structure (Cloverleaf model) | >WENV085278 Glu TTC
c ACGC ttccgctcct
G + T
C - G
C - G
C - G
C - G
C - G
A - T T C
T C T C T C A
C A A C | | | | | G
G T C T G G A G A G C
G + | | | T T
T G G A C
T A A CAAC
C A
C - G
A - T
G - C
A - T
C A
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |