| Sequence ID | >WENV085356 |
| Genome ID | BABC01000885 |
| Phylum/Class | Gut microbiome of Human (healthy human sample In-B, Infant, Male) |
| Species | |
|
Start position on genome
|
153
|
|
End posion on genome
|
78
|
|
Amino Acid
|
Arg
|
|
Anticodon
|
CCG
|
|
Upstream region at tRNA start position
|
gcagtggtgc
|
|
tRNA gene sequence
|
GGGCTCGTAGCTCAGTGGATAGAGCGTTCGCCTCCGGAGCGAAAGGTCGTGGGTTCGAAT CCCATCGAGCCCACCA
|
|
Downstream region at tRNA end position
|
ttgttctttc
|
| Secondary structure (Cloverleaf model) | >WENV085356 Arg CCG
c ACCA ttgttctttc
G - C
G - C
G - C
C - G
T - A
C - G
G - C T A
T T A C C C A
T G A A + | | | | G
G C T C G G T G G G C
G | | | | T T
A G A G C
T A G AGGTC
T - A
T - A
C - G
G - C
C - G
C A
T G
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |