| Sequence ID | >WENV085378 |
| Genome ID | BABC01001369 |
| Phylum/Class | Gut microbiome of Human (healthy human sample In-B, Infant, Male) |
| Species | |
|
Start position on genome
|
399
|
|
End posion on genome
|
488
|
|
Amino Acid
|
Ser
|
|
Anticodon
|
GGA
|
|
Upstream region at tRNA start position
|
ttgcataatT
|
|
tRNA gene sequence
|
GGAGAATTCGCCTAGTGGTCTATGGCGCACGCTTGGAAAGCGTGTTGGTGTAACAGCCTC ACGAGTTCGAATCTCGTATTCTCCGCCA
|
|
Downstream region at tRNA end position
|
Gcagggtttt
|
| Secondary structure (Cloverleaf model) | >WENV085378 Ser GGA
T GCCA Gcagggtttt
G - C
G - C
A - T
G - C
A - T
A - T
T - A T A
T T G C T C A
T G A C | | | | | G
G T C C G A C G A G C
G | | | T T
T T G G C
C T A G TTGGTGTAACAGCCTC
C - G
A - T
C - G
G - C
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |