| Sequence ID | >WENV086439 |
| Genome ID | BABF01003917 |
| Phylum/Class | Gut microbiome of Human (healthy human sample In-M, Infant, Female) |
| Species | |
|
Start position on genome
|
856
|
|
End posion on genome
|
934
|
|
Amino Acid
|
Arg
|
|
Anticodon
|
ACG
|
|
Upstream region at tRNA start position
|
acagtggtaT
|
|
tRNA gene sequence
|
GCGCCAGTAGCCCAGCGGATTAGAGCAGCTGACTACGGATCAGCAGGTCGCAGGTTCGAA TCCTGTCTGGCGCACAG
|
|
Downstream region at tRNA end position
|
Taagcctcga
|
| Secondary structure (Cloverleaf model) | >WENV086439 Arg ACG
T ACAG Taagcctcga
G - C
C - G
G - C
C - G
C - G
A - T
G - C T A
T T G T C C A
C G A A + | | | | G
G C C C G G C A G G C
G | | | T T
A G A G C
T T A A AGGTC
G - C
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |