| Sequence ID | >WENV086488 |
| Genome ID | BABF01009305 |
| Phylum/Class | Gut microbiome of Human (healthy human sample In-M, Infant, Female) |
| Species | |
|
Start position on genome
|
596
|
|
End posion on genome
|
519
|
|
Amino Acid
|
Arg
|
|
Anticodon
|
CCT
|
|
Upstream region at tRNA start position
|
aaacgtcgtT
|
|
tRNA gene sequence
|
GCCCGAGTAGCTCAGTGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGTCGGTTCGAAT CCGATCTCGGGCACTT
|
|
Downstream region at tRNA end position
|
Ggcttcggaa
|
| Secondary structure (Cloverleaf model) | >WENV086488 Arg CCT
T ACTT Ggcttcggaa
G - C
C - G
C - G
C - G
G - C
A - T
G - C T A
T T A G C C A
T G A A + | | | | G
G C T C G G T C G G C
G | | | | T T
A G A G C
T A A GTGTC
C - G
C - G
G - C
C - G
T - A
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |