The detailed information of tRNA gene sequence


Sequence ID>W1710015463
Genome IDAQQR01000020
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesMarinibacterium profundimaris (AQQR)
Start position on genome 70174
End posion on genome 70089
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
gaggcaccac
tRNA gene sequence
GCGGACATGGTGGAATGGTAGACACCGGAGACTTAAAATCTCCTGCTCAATCGAGCGTGC
GGGTTCGAGTCCCGCTGTCCGCACCA
Downstream region at tRNA end position
ttttataggc
Secondary structure (Cloverleaf model)
>W1710015463	Leu	TAA
                   c      ACCA ttttataggc
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     C - G
                     A - T          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G T G       G C G G G     C
    G         | | |                 T T
    T       A C A C
      A G          C     TGCTCAATCGAGCGT
                    G - C
                    G - C
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK