The detailed information of tRNA gene sequence


Sequence ID>W1710042875
Genome IDBBCB01000134
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesDesulfovibrio brasiliensis JCM 12178 (BBCB)
Start position on genome 3361
End posion on genome 3285
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
ggaccaagat
tRNA gene sequence
GGGCCTATAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTAGTTCAAA
TCTACCTAGGCCCACCA
Downstream region at tRNA end position
cgcttgtcct
Secondary structure (Cloverleaf model)
>W1710042875	Ile	GAT
                   t      ACCA cgcttgtcct
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     T - A
                     A - T          T A
                    T     C C A T C     A
      T G A        A      | | | | |     A
    T       C T C G       G G T A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK