The detailed information of tRNA gene sequence


Sequence ID>W1710046217
Genome IDBBFH01000018
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans JCM 21484 (BBFH)
Start position on genome 4291
End posion on genome 4376
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
caatcccggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
atatttccag
Secondary structure (Cloverleaf model)
>W1710046217	Leu	TAA
                   c      ACCA atatttccag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK