The detailed information of tRNA gene sequence


Sequence ID>W1710046233
Genome IDBBFH01000281
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans JCM 21484 (BBFH)
Start position on genome 1885
End posion on genome 1968
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
gcgcagaaag
tRNA gene sequence
GCCCGAGTGGCGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGCATGTCG
GTTCGAGTCCGACCTCGGGTACCA
Downstream region at tRNA end position
aatcctggtg
Secondary structure (Cloverleaf model)
>W1710046233	Leu	CAA
                   g      ACCA aatcctggtg
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C          T G
                    T     C A G C C     A
      T A A        G      | | | | |     G
    G       G G C G       G T C G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     CGCCGCAAGGCAT
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK