The detailed information of tRNA gene sequence


Sequence ID>W1710046250
Genome IDBBFH01001079
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans JCM 21484 (BBFH)
Start position on genome 398
End posion on genome 493
Amino Acid SeC(p)
Anticodon TCA
Upstream region at tRNA start position
tcggggatag
tRNA gene sequence
GGAAGAGAAGCGTCCCCGGTGGGGCGGCCGGACTTCAAATCCGGTTGGGGCAGTGAGCCT
GTCCCGGGTGGGTTCGACTCCCACTCTCTTCCGCCA
Downstream region at tRNA end position
gatgcgacga
Secondary structure (Cloverleaf model)
>W1710046250	SeC(p)	TCA
                   g      GCCA gatgcgacga
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T C
                    A     C A C C C     A
      C C C        G      | | | | |     G
    G       C T G C       G T G G G     C
    G       | + | |                 T T
    T       G G C G
      G G          G     TTGGGGCAGTGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK