The detailed information of tRNA gene sequence


Sequence ID>W1710049488
Genome IDBBOB01000003
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesType-C symbiont of Plautia stali (BBOB)
Start position on genome 35751
End posion on genome 35677
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgccgcac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tcttttattt
Secondary structure (Cloverleaf model)
>W1710049488	Arg	CCT
                   c      ACCA tcttttattt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK