The detailed information of tRNA gene sequence


Sequence ID>W1710049560
Genome IDBBOC01000006
Search identical group
Phylum/ClassFirmicutes
SpeciesType-D symbiont of Plautia stali (BBOC)
Start position on genome 69042
End posion on genome 69116
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tgcgcgccgc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
ttagccgcat
Secondary structure (Cloverleaf model)
>W1710049560	Arg	CCT
                   c      ACCA ttagccgcat
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK